Can anyone help me with the genetic code?
Can anyone help me with the genetic code?
Properties of the genetic code?
I know the following: unambiguous, universal, degenerate, comma-free, overlap-free Could one also add a direction-specific definition (i.e., that it must always be read in the 5' 3' direction)? (I never read this in textbooks/the internet)
genetics biological code?
Good day, Can anyone tell me how the genetic code is encrypted? I don't understand how anyone comes up with that.
Genetic code, which amino acid is coded?
Hello! Can someone help me solve this problem? I've tried everything, but unfortunately, it hasn't worked, including my teaching materials and the internet. If anyone can help me, I would be very grateful if you could tell me step by step how I should proceed to achieve the result.
Gene therapy and Crispr?
Hello, I have to teach a lesson soon as a student in my biology class. I'm introducing the topic of gene therapy with bacteria. Since CRISPR is a type of gene therapy, I need assignments on the topic of gene therapy with bacteria that the class can work on. I'm coming up with ideas like…
Genetics: Is it better to use only female animals as components for a chimera that is intended to be female?
Does the gender of the components affect the outcome at all? And if the chimera turns out to be male, can it be genetically transformed into a female (before birth)?
Genetic code: code sun?
Hello, I have already solved the following task myself, but I still have a question: Determine the amino acid sequence encoded in the following DNA segment: 3'TACAAGCAGTTAGTCGTGGAAACACCAAGTAT C5' 5'AT GTT CGT CAAT CAGCACCTTTGTGGTTCAT AG3' My solution: I would be very happy if someone who knows a lot about this could take a look and see…
Translate genetic code?
Could someone translate the mRNA directly using the table? I'm stuck 🙁
What is your opinion on designer babies?
We are making great progress in the field of genetic engineering and at some point in the future there will most likely be the option to make your child look the way you want it to.
Why does a base triplet consist of only 3 nucleotides?
A nucleotide consists of a phosphate, a sugar molecule, and a base. Since a base triplet consists of three base pairs, shouldn't six nucleotides form a triplet?
genetic code, help?
Unfortunately, I don't have another picture, but I hope it's legible. =( Hello everyone, could someone please explain the consequences for polypeptide synthesis? (see image) Does this mean that after the ribosome reaches the stop codon, peptide synthesis is terminated because there is no tRNA with a matching anticodon? Best regards and thanks for all…
What do you think of this idea of history?
A man who secretly runs a lab in his basement wants to create a mega badboy with his team by taking the genes of various men—for his voice, his looks, his abilities, and some character traits. And yes, it's about cloning and hybridizing humans.