I'm currently studying for a biology exam and can't find anything online about this question. Since it's on the list of things I'm supposed to know, I wanted to ask if it's possible to translate amino acid sequences into gene sequences (code sun, genetic code, etc.), and if so, how?
Hello, I have already solved the following task myself, but I still have a question: Determine the amino acid sequence encoded in the following DNA segment: 3'TACAAGCAGTTAGTCGTGGAAACACCAAGTAT C5' 5'AT GTT CGT CAAT CAGCACCTTTGTGGTTCAT AG3' My solution: I would be very happy if someone who knows a lot about this could take a look and see…
For me 4 bases are wrong here and not 3. Where is my mistake? In the lower row are the base triplets of the mRNA and in the upper row are their anticodons.